Autarchy of the Private Cave

Tiny bits of bioinformatics, [web-]programming etc

  • Categories

  • Tags list

GeneDoc: DNA editing, alignment, analyser and shading software

25th June 2007

Full Featured Multiple Sequence Alignment Editor, Analyser and Shading Utility for Windows.

Small and convenient. Can do sequence alignments (I recommend to limit the length to 2kb for alignments).

Latest version I found: updated July, 2001, GeneDoc version # 2.6.02.

Drawback: windows only (but has GNU-licence sources).

Share

2 Responses to “GeneDoc: DNA editing, alignment, analyser and shading software”

  1. FATIMA Says:

    >A.tumefaciens_CCNWNX0078_EU697966.1
    TGCAAGTCGAACGCCCCGCAAGGGGAGTGGCAGACGGGTGAGTAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAGCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGATTTATCGGGGAAGGATTGGCCCGCGTTGGATTAGCTAGTTGG
    TGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCT
    CTTTCACCGGAGAAGATAATGACGGTATCCGGAGA
    AGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGTT
    CGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCAG
    AGCTCAACTCTGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGA
    ATTCCGAGTGTAGAGGTGAAATTCG
    >IEC10 .
    gGggaGTGGCAgACGGGTGAgtaACgCGTGGGAACAtAC
    CCTTTCCtGCggAAtAgCTCCgGgAAACTGGaaTTAATACCGCaTACgCCCtACGGGGGA
    AAGATttATCGgGGAAgGAtTGGCCCGCgtTGGatTAgCTAgttGG
    tGGGGTAAAGGCCTACCAagGCGACgATCCATAgCTGGtCTGAgAgGATGAtCAgCCACa
    TTGGGACTGAGACACGGCCCAaACTCCTACGGGAGGCAgCAgTGGGGAATATTGgACAAT
    GggCGCAaGCCTgATCCAgCCATGCCGCGTGAGTGATGAAgGCCTTAgGGTTGTAAAGCT
    CTTTCACCGGAgAAgATAATGACGgTATCCGgAgA
    AgAAGCCCCGGCTAACTTCGtGCCAgCAGCCGCgGtAATACGAAgGGgGCTAgCGTTGTT
    CggAATTACTGg
    >IRC61 .
    GCAAGGGGAGTGGCAgACGGGTGAgTAACGCGTGGGAACATAC
    CCttTCCTGCGGAATAGCTCCGGGAAACTGGAaTTAATACCGCaTACGCCCTACGGGGGA
    AAGAttTATCGGGGAAGGAtTGGCCCGCgttGGATTAgCTAGtTGG
    tGGGGtAAAGGCCTACCAAGGCGACgATCCATAgCTGGtCTGAgAGGATGATCAGCCACa
    TTGGGACTGAgACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATAttGGACAAT
    GGGCGCAaGCCTGATCCAgCCATGCCGCGtGAGtGATGAAgGCCTTAgGGtTGTAAAGCT
    CTTTCACCGGAgAAgATAATGACGGtaTCCGGAgA
    AgAAGCCcCGGCTAACTTCGtGCcAgCAGCCGCGGtAATACGAAGggGGCTAGCGTTgTT
    CGgAATtACTGgGCGTAaAGCGCACGTAgGCGgATATtTAAgTCAgGgGtGAaATcCCAg
    AgCTCAaCtCTGgaACTGCCtTTgATACTGgGtATCTTg
    >A.tumefaciens_B5_EF661856.1
    TGCAAGTCGAACGCCCCGCAAGGGGAGTGGCAGACGGGTGAGTAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAGCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGATTTATCGGGGAAGGATTGGCCCGCGTTGGATTAGCTAGTTGG
    TGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCT
    CTTTCACCGATGAAGATAATGACGGTAGTCGGAGA
    AGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGTT
    CGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCGC
    AGCTCAACTGCGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGA
    ATTCCGAGTGTAGAGGTGAAATTCG
    >RCM12 .
    ACGGGTGAgtAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAgCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGATTTATCGGGGAAGGATTGGCCCGCGtTGGATTAGCTAGTTGG
    TGGGGTAAAGGCCTACCAAGGCGACGATCCATAgCTGGtCtGAGAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAgTGATGAAGGCCTTAgGGTTGTAAAGCT
    CTTTCACCGATGAAgATAATGACGGTAGTCGGAgA
    AgAAGCCCCGGCTAACTTCGTGCCAgCAGCCGCGGTAATACGAAgGGGGCTAGCGTTGTT
    CgGaATTACTGGGCGt
    >RCM3mod .
    ACGGGTGAgtAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAGCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGATTTATCGGGGAAGGATTGGCCCGCGtTGGATTAGCTAGTTGG
    TGGGGTAAAGGCCTACCAAGGCGACGATCCATAgCTGGtCtGAGAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAgTGATGAAGGCCTTAgGGTTGTAAAGCT
    CTTTCACCGATGAAgATAATGACGGTAGTCGGAgA
    AgAAGCCCCGGCTAACTTCGTGCCAgCAGCCGCGGTAATACGAAgGGGGCTAGCGTTGTT
    CgGnATTACTGGGCGt
    >RCM9mod .
    AACGCCCCGCaaGGGGAGTGGCAGACGGGTGAGTAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAGCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGATTTATCGGGGAAGGATTGGCCCGCGTTGGATTAGCTAGTTGG
    TGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCT
    CTTTCACCGATGAAGATAATGACGGTAGTCGGAGA
    AGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAgGGGGCTAGCGTTGTT
    CGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCGC
    AGCTCAaCTGCGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGA
    ATTCC
    >IRC43 .
    TCgAACgCCCCGCAaGGGGAGTGGCAgACGGGTGAgTAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAGCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGATTTATCGGGGAAGGATTGGCCCGCGTTGGAtTAGCTAGtTGG
    tGGGGTAAAGGCCTACCAAGGCGACGATCCATAgCtGGtCtGAgAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAaGCCTGATCCAgCCATGCCGCGtGAGTGATGAAgGCCTTAgGGTTGTAAAGCT
    CTTTCACCGATGAAgATAATGACGGTAGTCGGAgA
    AgAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAgGGGGCTAGCGTTGTT
    CGGAATTACTGgGCGTAaAGCGCACGTAgGCGgATATTtAAGTCAgGGGTGAAATCCCGC
    AGCTCAaCTGCGgAaCTGCCTTTGATACTGgGTATCTTGA
    >IRC51 .
    TGCaAgTCgAACGCCCCGCAAGGGGAGTGGCAGACGGGTGAGTAACGCGTGGGAACATAC
    CCTTTCCTGCGGAATAGCTCCGGGAAACTGGAATTAATACCGCATACGCCCTACGGGGGA
    AAGaTTTATCGGGGAAGGATTGGCCCGCGTTGGATTAGCTAGTTGG
    TGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACA
    TTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCT
    CTTTCACCGATGAAGATAATGACGGTAGTCGGAGA
    AGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGTT
    CGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAgGGGTGAAATCCCGC
    AGCTCAaCTGCGGAACTGCCTTTGATACTGGGTATCTTGAGTaTGGAAGAGGTAAGTGGA
    ATTCCGAGTgTAGAGgTGAAATTCg

    >IEC4mod

    >AgAgAAgCTTGCTTCTcTTGAgAGCGGCGGACGGgTGAgTAATGCCTAgGAaTCTGC
    CtGgtagTGGGGgnnnACgtTCGGAAACGGACgCTAATACCGCATACgTCCTACGGGAgA
    AAGCAGGGGACCTTCGGGCCTTGCgCTATCAGATGAGCCTAgGTCGGATTAGCTAGtTGG
    tGGGGTAATGGCTCACCAAGGCGACGATCCGTAaCTGGtCTGAgAgGATGATCAGTCACA
    CTGGAACTGAgACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGAAAGCCTGATCCAgCCATGCCGCGTGTGTGAAGAAgGTCTTCGgATTGTAAAGCA
    CTTTAAGTTGGgAgGAAGGGCAGTTACCTAATACGTAATTGTTtTGACGTTACCGACAGA
    ATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGtAATACAgAGGGTGCAAGCGTTAAT
    CGgAATTACTGgG
    >IRC1 .

    >AgAgAAgCTTGCTTCTCTTGagAgCGGCGGaCGGgTGAgTAAtGCCTAgGAAtCtGC
    CtGGtAgTGGgggatAACgttCgGAAACGGACgCTAATACCGCATACgTCCTACGGGAGA
    AAGCAGGGGACCTTCgGGCCTTGCgCTATCAGATGAgCCTAgGtCGGATTAgCTAGtTGG
    tGGGGTAATGGCTCACCAagGCGACGATCCGTAaCTGGtCTGAgAgGATGATCAgTCACA
    CTGGAACTGAgACACGGTCCAgACTCCTACGGGAGGCAgCAGTGGGGAATATTGGACAAT
    GGgCGAAAGCCTGATCCAgCCATGCCGCGTGTGtGAAGAAgGTCTTCggATTGtAAAGCA
    CTTTAAGTTGGgAgGAAGGGCAgTTACCTAATACGTAATTGTTTTGACGTTACCGACAgA
    ATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAgAgGGTGCAAGCGTTAAT
    CGGAATTACTgGGCGTaAAGCgCgCG

    >pseudomonas poas
    >TAGAGAGAAGCTTGCTTCTCTTGAGAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGC
    CTGGTAGTGGGGGATAACGTTCGGAAACGGACGCTAATACCGCATACGTCCTACGGGAGA
    AAGCAGGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGG
    TGGGGTAATGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACA
    CTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAAT
    GGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCA
    CTTTAAGTTGGGAGGAAGGGCAGTTACCTAATACGTAATTGTTTTGACGTTACCGACAGA
    ATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAAT
    CGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCG
    GGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGA

  2. Bogdan Says:

    yes, these could be edited with GeneDoc :)

Leave a Reply

XHTML: You can use these tags: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>